View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12890_high_3 (Length: 402)
Name: NF12890_high_3
Description: NF12890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12890_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 12 - 153
Target Start/End: Original strand, 28966314 - 28966455
Alignment:
| Q |
12 |
agagacagaaaatcaaagctggaccagttggtgttggtggtagggtcagcattagccattagcaatacaaagaaaggacgtacaccattatttttccagg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28966314 |
agagacagaaaatcaaagctggaccagttggtgttgatggtagggtcagcattagccattagcaatacaaagaaaggacgtacaccattatttttccagg |
28966413 |
T |
|
| Q |
112 |
gtggagcacatgatacaagttatgcaaaatatatgatactat |
153 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28966414 |
gtggagcacatgatacaagttgtgcaaaatatatgatactat |
28966455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 250 - 384
Target Start/End: Original strand, 28966552 - 28966686
Alignment:
| Q |
250 |
gtgggtcggtcactaggaaaaagcgtgtcctaaccgatgattaatcagtaaccattgttagaagaattgtcacaaagggacaagaaaaagaaagctaaaa |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28966552 |
gtgggtcggtcactaggaaaaagcgtgtcctaaccgatgattaatcagtaaccattattagaagaattgtcacaaaaggacaagaaaaagaaagctaaaa |
28966651 |
T |
|
| Q |
350 |
attaggtcacaatacaatagttgggagttctgagt |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28966652 |
attaggtcacaatacaatagttgggagttctgagt |
28966686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University