View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12890_high_9 (Length: 223)
Name: NF12890_high_9
Description: NF12890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12890_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 10044288 - 10044481
Alignment:
| Q |
18 |
ctttggatatgggagcgttagtcgctggtactcagtataggggacaatttgaacaaaggttgaaggcagttttgaaagaagtggaagatgctgaagggaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10044288 |
ctttggatatgggagcgttagtcgctggtactcagtataggggacaatttgaacaaaggttgaaggcagttttgaaagaagtggaagatgctgaagggaa |
10044387 |
T |
 |
| Q |
118 |
ggttattgttttcattgatgaaattcatcttgttctcggtgccggtcaatgtcaaggatcaatggatgctgctaatcttttgaaacctatgctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10044388 |
ggttattgttttcattgatgaaattcatcttgttctcggtgccggtcaatgtcaaggatcaatggatgctgctaatcttttgaaacctatgctt |
10044481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 21 - 211
Target Start/End: Original strand, 45466403 - 45466593
Alignment:
| Q |
21 |
tggatatgggagcgttagtcgctggtactcagtataggggacaatttgaacaaaggttgaaggcagttttgaaagaagtggaagatgctgaagggaaggt |
120 |
Q |
| |
|
||||||||||||| || || |||||| | ||||||||||| |||||||| | ||||||||||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
45466403 |
tggatatgggagcattggttgctggtgcgaagtataggggagaatttgaagagaggttgaaggctgttttgaaagaagttgaagaagctgaagggaaggt |
45466502 |
T |
 |
| Q |
121 |
tattgttttcattgatgaaattcatcttgttctcggtgccggtcaatgtcaaggatcaatggatgctgctaatcttttgaaacctatgctt |
211 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| || || ||| | |||||||||||||||||||||||||||| || || |||||| |
|
|
| T |
45466503 |
tattcttttcattgatgagattcatcttgttcttggagctggtagaacagaaggatcaatggatgctgctaatctttttaagccaatgctt |
45466593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University