View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12890_low_3 (Length: 433)
Name: NF12890_low_3
Description: NF12890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12890_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 3e-73; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 209 - 360
Target Start/End: Original strand, 31186063 - 31186214
Alignment:
| Q |
209 |
ccactaaaatcatgtaattgccatgtaaatcatctttttacttttatacgcggtgatcaacagtggcctttggaaaaaggaagctggctcatgcaacaaa |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31186063 |
ccactaaaatcatgtaattgccatgtaaatcatctttttacttttatacgcggtgatcaacggtggcctttggaaaaaggaagctggcgcatgcaacaaa |
31186162 |
T |
|
| Q |
309 |
gcattgatatttttaaaggcaaatgatgttagaatctggaaattaggtttat |
360 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31186163 |
gcattgatttttttaaaggcaaatgatgttagaatctggaaattaggtttat |
31186214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 170 - 209
Target Start/End: Original strand, 31185996 - 31186035
Alignment:
| Q |
170 |
gatgacattttcaacaggcccgacataaaggagaccctac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31185996 |
gatgacattttcaacaggcccgacataaagtagaccctac |
31186035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 382 - 415
Target Start/End: Original strand, 31186213 - 31186246
Alignment:
| Q |
382 |
atttagagagaagataggcagattatgtactaaa |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31186213 |
atttagagagaagataggcagattatgtactaaa |
31186246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 170 - 209
Target Start/End: Original strand, 31207089 - 31207128
Alignment:
| Q |
170 |
gatgacattttcaacaggcccgacataaaggagaccctac |
209 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
31207089 |
gatgacattttcaataggcccaacataaaggagaccctac |
31207128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University