View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_high_39 (Length: 355)
Name: NF12891_high_39
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 56219669 - 56219861
Alignment:
| Q |
18 |
agcgaagcgtgtggagtgagagaaaacgaggttgttaagagtgatgtagaagtgttggagttggggggtgtggaagtaaggattttgatcaagtggattt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56219669 |
agcgaagcgtgtggagtgagagaaaacgaggttgttattagtgatgtagaagtgttggagttggggggtgtggaagtaaggattttgatcaagtggattt |
56219768 |
T |
 |
| Q |
118 |
gggaaggttttgaggttggagatgtagtggttgagatgaggaagatcttttagcttaatgggttcgaataagtttgttacatcttcgagttct |
210 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56219769 |
gggaaggttttgaggtttgagatgtagtggttgagatgaggaagatcttttagcttaatgggttcgaataagtttgttacatcttcgagttct |
56219861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 56219942 - 56220003
Alignment:
| Q |
282 |
aacgatcaaccgctttgacg---actttcaatacgtggcgctcactgtgtttaacatcacat |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56219942 |
aacgatcaaccgctttgacgacgactttcaatacgtggcgctcactgtgtttaacatcacat |
56220003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University