View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_high_56 (Length: 283)
Name: NF12891_high_56
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_high_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 25 - 279
Target Start/End: Original strand, 137371 - 137625
Alignment:
| Q |
25 |
gttggtatgacagtgaagaatcttcatctgagtcttcaacaataatatcaaaagagcagtatgatcaaagagaagtaatagagaaacagaatgttcttgt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137371 |
gttggtatgacagtgaagaatcttcatctgagtcttcaacaataatatcaaaagagcagtatgatcaaagagaagtaatagagaaacagaatgttcttgt |
137470 |
T |
|
| Q |
125 |
agttgctggttgcaagatctgtctcatgtatttcatggtgccaaaacaagttgaagattgcccaaaatgtagtggtcaacttctccactttgatcgatcc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
137471 |
agttgctggttgcaagatctgtctcatgtatttcatggtgccaaaacaagttgaagattgcccaaaatgtagtggtcaacttctccactttgatcgatcc |
137570 |
T |
|
| Q |
225 |
gaaaattgctctccttaattcattctcaattaaattcaaccctttcttctctctc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
137571 |
gaaaattgctctccttaattcattctcaattaaattcaaccctttcttttctctc |
137625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University