View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_high_73 (Length: 243)
Name: NF12891_high_73
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_high_73 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 44650393 - 44650166
Alignment:
| Q |
18 |
tataatttataggtgaattgttgttatggtaattcacgtccttaatttgtgcttccatattgtatacttttaagttaactttggtaattcattcatggtc |
117 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44650393 |
tataatttataggtaaattattgttatggtagttcacgtccttaatttgtgcttccatattgtatacttttaagttaactttggtaattcattcatggtc |
44650294 |
T |
|
| Q |
118 |
cttagtttgtgctttcgagaccgagtagctctatactagaagactc--atatatattcgcatgacaaatgatagaaatcaaacatctttgtaaagtttga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44650293 |
cttagtttgtgctttcgagaccgagtagctctatactagaagactcagatatatattcgcatgacaaatgatagaaatcaaacatctttgtaaagtttga |
44650194 |
T |
|
| Q |
216 |
gagttcccacctttaatcaaacaatcgt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
44650193 |
gagttcccacctttaatcaaacaatcgt |
44650166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University