View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_high_74 (Length: 243)
Name: NF12891_high_74
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_high_74 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 177
Target Start/End: Complemental strand, 37025306 - 37025147
Alignment:
| Q |
18 |
tttcttttaacaccatgaaaaggatctaaagcaatagttttcaattcataaagaagccttctacacacatgcagaaatttactggctgaaacatcaacct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37025306 |
tttcttttaacaccatgaaaaggatctaaagcaatagttttcaattcataaagaagccttctacacacatgcagaaatttactggctgaaacatcaacct |
37025207 |
T |
 |
| Q |
118 |
tgcctgacggatgtgcaaatttttcagaagtagaaggtttctccacatggctcgaggttg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37025206 |
tgcctgacggatgtgcaaatttttcagaagtagaaggtttctccacatggctcgaggttg |
37025147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 197 - 233
Target Start/End: Complemental strand, 37025130 - 37025094
Alignment:
| Q |
197 |
accaacagcagaaaattcagagttcaaatcatctgtg |
233 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37025130 |
accaacagcagaaaactcagagttcaaatcatctgtg |
37025094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University