View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_high_86 (Length: 238)
Name: NF12891_high_86
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_high_86 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 2484542 - 2484321
Alignment:
| Q |
1 |
aaactaaaactagttagtagttacctctttgttgcctaaatggaaactgaaacatcaaaactagtactttcatcgtccatgtgaaactaagttccaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2484542 |
aaactaaaactagttagtagttacctctttgttgcctaaatggaaactgaaacatcaaaactagtactttcatcgtccatgtgaaactaagt-ccaataa |
2484444 |
T |
 |
| Q |
101 |
gggagtaggaattgcagaggtgggaactatatattagagagcacaagagtaagccaatccctttagtaaagatagatatgctcatagggataagctttaa |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2484443 |
gggagtaagaattgcagaggtgggaactatatattagagagcacaagagtaagccaatccctttagtaaagatggatatgctcatagggataagctttaa |
2484344 |
T |
 |
| Q |
201 |
tcagaattgcagaggtgggaact |
223 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
2484343 |
tcagaattgcagaggtggtaact |
2484321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 5 - 114
Target Start/End: Original strand, 7438268 - 7438377
Alignment:
| Q |
5 |
taaaactagttagtagttacctctttgttgcctaaatggaaactgaaacatcaaaactagtactttcatcgtccatgtgaaactaagttccaataaggga |
104 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7438268 |
taaaactagttagtagtaacctctttgttgcctaaatggaaactgaaacatcaaaacaagtactttcatcgtccatgtgaaactaagttccaataagggt |
7438367 |
T |
 |
| Q |
105 |
gtaggaattg |
114 |
Q |
| |
|
|||||||||| |
|
|
| T |
7438368 |
gtaggaattg |
7438377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 109 - 158
Target Start/End: Complemental strand, 2484340 - 2484291
Alignment:
| Q |
109 |
gaattgcagaggtgggaactatatattagagagcacaagagtaagccaat |
158 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
2484340 |
gaattgcagaggtggtaactatatattagagagcacaagagtaagtcaat |
2484291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 125 - 171
Target Start/End: Original strand, 7438650 - 7438696
Alignment:
| Q |
125 |
aactatatattagagagcacaagagtaagccaatccctttagtaaag |
171 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7438650 |
aactatatgttagagagcacaaaagtaagccaatccctttagtaaag |
7438696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 158
Target Start/End: Complemental strand, 2494575 - 2494525
Alignment:
| Q |
108 |
ggaattgcagaggtgggaactatatattagagagcacaagagtaagccaat |
158 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
2494575 |
ggaattgcagaggagataactatatattagagagcacaggagtaacccaat |
2494525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University