View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_high_88 (Length: 236)
Name: NF12891_high_88
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_high_88 |
 |  |
|
| [»] scaffold0432 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0432 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0432
Description:
Target: scaffold0432; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 21 - 82
Target Start/End: Complemental strand, 6857 - 6796
Alignment:
| Q |
21 |
attacttgtaaataaagtaacaaactagttagttacttgttccataagaaactagtttgtta |
82 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6857 |
attacttgtgaataaagtaacaaactagttagttacttgttccataagaaactagtttgtta |
6796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University