View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_high_91 (Length: 227)
Name: NF12891_high_91
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_high_91 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 17304012 - 17303792
Alignment:
| Q |
7 |
tcctcttcatctcaatttgcataaaattcgttcctcttcgtcttctcattcacgatctccccctcctcttcccgttttctggaccataggatcccgaccc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17304012 |
tcctcttcatctcaatttgcataaaattcgttcctcttcgtcgtctcattcacgatctccccctcctcttcccgttttctggaccataggatcccgaccc |
17303913 |
T |
|
| Q |
107 |
aagtcagagaaacgccttgggtcagggtgctgggtccaggtattcgggaacggggacgcttacgagggggagtttcataaggggaagtgttcagggagtg |
206 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17303912 |
aagtcagagaaacgccttgggtcggggtgctgggtccaggtattcgggaacggggacgtttacgagggggagtttcataaggggaagtgttcagggagtg |
17303813 |
T |
|
| Q |
207 |
gtgtttattattatagtatga |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
17303812 |
gtgtttattattatagtatga |
17303792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 176 - 214
Target Start/End: Complemental strand, 41090417 - 41090379
Alignment:
| Q |
176 |
gagtttcataaggggaagtgttcagggagtggtgtttat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41090417 |
gagtttcataaggggaagtgttcagggagtggtgtttat |
41090379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University