View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_high_93 (Length: 224)
Name: NF12891_high_93
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_high_93 |
 |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0606 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 4191 - 4416
Alignment:
| Q |
1 |
tattgtactctctacaagtacacatgtgctgcgagatagttttttatgttgaaattattaaaattttatttgcaatctactaagtcttttgatagattaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4191 |
tattgtactctttacaagtacacatgtgctgcgagatagttttttatgttgaaattattaaaattttatttgcaatctactaagtcttttgatagattaa |
4290 |
T |
 |
| Q |
101 |
gtagccatgctttgatttttattaaaatattttgttcactagtagggtatgatttcctccaactgtatt-aattaacaccagatctcggat--------c |
191 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |||||| | |
|
|
| T |
4291 |
gtagccatactttgatttttattaaaatattttgttcactagtagggtatcatttcctccaactgtattaaattaacaccagatatcggatcccaaacac |
4390 |
T |
 |
| Q |
192 |
ccgaacccgattgaaccttcttctca |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4391 |
ccgaacccgattgaaccttcttctca |
4416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University