View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_low_100 (Length: 219)
Name: NF12891_low_100
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_low_100 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 3 - 201
Target Start/End: Complemental strand, 36050850 - 36050652
Alignment:
| Q |
3 |
tattgattcggataagaagtcgatgtttcagtctaaaacaaagaagactttaaatttaaagaatactccctttaaaaatattagctagtcgaacatcaaa |
102 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36050850 |
tattgattcagataagaagtcgatgtttcaatctaaaacaaagaagactttaaatttaaagaatactccctttaaaaatattagcgagtcgaacatcaaa |
36050751 |
T |
 |
| Q |
103 |
cctccttattcaaaaatatagtttagttgaatgagtgcccatcaactgaacacatacgactatactaatgttgggtgataaggggtcttgggtatcatc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
36050750 |
cctccttattcaaaaatatagtttagttgaatgagtgtccatcaactgaacacatatgattataccaatgttgggtgataaggggtcctgggtatcatc |
36050652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University