View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_low_39 (Length: 366)
Name: NF12891_low_39
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_low_39 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 1e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 228 - 358
Target Start/End: Original strand, 32343603 - 32343733
Alignment:
| Q |
228 |
tcagaaggtgtatcaaagaaccattccggctttttcacatcttctttttcattcttcaagttccttccatatgcattgtgggacattcccaacactaagc |
327 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32343603 |
tcagatggtgtatcaaagaaccattccggctttttcacatcttctttttcattcttcaagttccttccatatgcattgtgggacattcccaacactaagc |
32343702 |
T |
|
| Q |
328 |
atattcctacaaccaaaatgaacttcatctc |
358 |
Q |
| |
|
|||| || ||||||||||||||||||||||| |
|
|
| T |
32343703 |
atatccccacaaccaaaatgaacttcatctc |
32343733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University