View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_low_45 (Length: 348)
Name: NF12891_low_45
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 5e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 17 - 174
Target Start/End: Complemental strand, 43357322 - 43357165
Alignment:
| Q |
17 |
acatgtggcatgtgatataaatgaagcacttatttttgtgttaaaaagttaagtttgttgatgtctaatctcagtgatcactcttgagtgggacactgcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43357322 |
acatgtggcatgtgatataaatgaagcacttatttttgtgttaaaaagttaagtttgttgatgtctaatctcagtgatcactcttgagtgggacactgcc |
43357223 |
T |
 |
| Q |
117 |
atcaatttattctaatcaattcaggagaacacatatgcttgcatgaatctggttcttt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43357222 |
atcaatttattctaatcaattcaggagaacacatatgcttgcatgaatctggttcttt |
43357165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 256 - 322
Target Start/End: Complemental strand, 43357083 - 43357017
Alignment:
| Q |
256 |
cccgaccctcgttatcagcctaaggattttttgatcaaattttatcgcatatttatgtagtgtagtg |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43357083 |
cccgaccctcgttatcagcctaaggattttttgatcaaattttatcgcatatttatgtagtgtagtg |
43357017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University