View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_low_67 (Length: 264)
Name: NF12891_low_67
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_low_67 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 29 - 198
Target Start/End: Original strand, 5284159 - 5284328
Alignment:
| Q |
29 |
agagtggaattttaaaaggggtttcagaaaccctagaattgtcattttgtgattgaaatggcttcaggggcaattttcttatcgctgcggcggcgaagat |
128 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5284159 |
agagtggaatttcaaaaggggtttcagaaaccctagaattttcattttgtgattgaaatggcttcaggggcaattttctcatcgctgcggcggcgaagat |
5284258 |
T |
 |
| Q |
129 |
cacctgcattggaagcttttctagctcccgttgaattaagcgacgttgctttggttcaaacgattgtaac |
198 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
5284259 |
cacctacattggaagcttttctagctcccgttgatttaagcgacgttgctttggttcaaacccttgtaac |
5284328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University