View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12891_low_67 (Length: 264)

Name: NF12891_low_67
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12891_low_67
NF12891_low_67
[»] chr2 (1 HSPs)
chr2 (29-198)||(5284159-5284328)


Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 29 - 198
Target Start/End: Original strand, 5284159 - 5284328
Alignment:
29 agagtggaattttaaaaggggtttcagaaaccctagaattgtcattttgtgattgaaatggcttcaggggcaattttcttatcgctgcggcggcgaagat 128  Q
    |||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
5284159 agagtggaatttcaaaaggggtttcagaaaccctagaattttcattttgtgattgaaatggcttcaggggcaattttctcatcgctgcggcggcgaagat 5284258  T
129 cacctgcattggaagcttttctagctcccgttgaattaagcgacgttgctttggttcaaacgattgtaac 198  Q
    ||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||  |||||||    
5284259 cacctacattggaagcttttctagctcccgttgatttaagcgacgttgctttggttcaaacccttgtaac 5284328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University