View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_low_68 (Length: 264)
Name: NF12891_low_68
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_low_68 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 37 - 254
Target Start/End: Original strand, 5037253 - 5037469
Alignment:
| Q |
37 |
atcatatcatatctagtttaagatatggtgttcgtgtggttccttgcttcacacctcacgtgactatagtgctgctagctacaatgtatattcttcnnnn |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5037253 |
atcatatcatatctagtttaagatatggtgttcgtgtggttccttgcttcacacctcacgtgactatagtgctgctagctacaatgtatattcttctttt |
5037352 |
T |
|
| Q |
137 |
nnngataacaacttctcaaccataaattatggttatctcttccagttttaaacttaaaaatgacaacaaaaaattgtttagatctatgcattctgtttta |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5037353 |
tttgataacaacttctcaaccataaattatggttatctcttccagttttaaacttaaaaatgacaacaaaaaattgtttagatctatgcattctgtttta |
5037452 |
T |
|
| Q |
237 |
accttaaggctctgttct |
254 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
5037453 |
accttaagg-tctgttct |
5037469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University