View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_low_81 (Length: 242)
Name: NF12891_low_81
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_low_81 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 26900038 - 26900270
Alignment:
| Q |
1 |
tatgctgtttgatgcatgctgaaggttccaaaaaggaaaacatattgcaagttcagacagtttggaccacatggtatgctcctcaataagcacatatcat |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26900038 |
tatgctttttgatgcatgctgaaggttccaaaatggaaaacatattgcaagttcagacactttggaccacatggtatgctcctcaatatgcacatatcat |
26900137 |
T |
 |
| Q |
101 |
--cactataagatactttgtctatttttggttattgttctatctatactctattttaaggtaaaaattgta--tctaacatctaa-----ttcttacata |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
26900138 |
cacactataagatactttgtctatttttggttattgttctatctatagtctattttaaggtaaaaattgtaactctaacatctaattcttttcttacata |
26900237 |
T |
 |
| Q |
192 |
gccaaataaacaaattcagatgactacaatgat |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
26900238 |
gccaaataaacaaattcagatgactataatgat |
26900270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University