View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_low_88 (Length: 238)
Name: NF12891_low_88
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_low_88 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 54 - 223
Target Start/End: Original strand, 45363237 - 45363406
Alignment:
| Q |
54 |
tttgctccttttcctttatgattctgttcatggcaggtctgttcatggctttgcaaccgaggattatagcatgaggtaatcgcatagcagctttctctat |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45363237 |
tttgctccttttcctttatgattctgttcatggcaggtctgttcatggctttgcaaccgaggattatagcatgtggtaatcgcatagcagctttctctat |
45363336 |
T |
|
| Q |
154 |
ggccattagattccttaccggtccagctgtcatggcagctgcttccattgttgttggactcagaggaacc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45363337 |
ggccattagattccttaccggtccagctgtcatggcagctgcttccattgttgttggactcagaggaacc |
45363406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 87 - 215
Target Start/End: Original strand, 25041973 - 25042101
Alignment:
| Q |
87 |
caggtctgttcatggctttgcaaccgaggattatagcatgaggtaatcgcatagcagctttctctatggccattagattccttaccggtccagctgtcat |
186 |
Q |
| |
|
||||| ||||||||||||||||||| | || |||||||| || ||| ||| |||||||| || |||| | ||||||||| |||||||||||||| |
|
|
| T |
25041973 |
caggtttgttcatggctttgcaaccaaaaatcatagcatgtggaaattccattgcagctttttcaatgggtgtgagattccttgttggtccagctgtcat |
25042072 |
T |
|
| Q |
187 |
ggcagctgcttccattgttgttggactca |
215 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |
|
|
| T |
25042073 |
ggcagctgcttcatttgctgttggactca |
25042101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University