View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12891_low_93 (Length: 235)
Name: NF12891_low_93
Description: NF12891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12891_low_93 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 41744770 - 41744989
Alignment:
| Q |
1 |
cattatacttttacattttttgtagatcattatttgtaccccttacatgtatttccggccttttctgtaaatgtgcccagtaattagactaaaaagatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41744770 |
cattatacttttacattttttgtagatcattatttgtaccccttacatatatttccggccttttctgtaaatgtgcccagtaattagactaaaaagatca |
41744869 |
T |
|
| Q |
101 |
ctttcatcattgtataaaattaggttgaatggaataaagtactcactatgtagtgtgtcaaacatgattattcagaattgtgtgcaccatgcgcacttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41744870 |
ctttcatcattgtataaaattaggttgaatggaataaagtactcactatgtagtgtgtcagacatgattattcagaattgtgtgcaccatgcgcacttgc |
41744969 |
T |
|
| Q |
201 |
ctaataacattatacatatc |
220 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
41744970 |
ctaaaaacattatacatatc |
41744989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University