View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12893_low_4 (Length: 301)
Name: NF12893_low_4
Description: NF12893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12893_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 290
Target Start/End: Complemental strand, 47234781 - 47234509
Alignment:
| Q |
18 |
atcatcacctgaccaaggatacacagaaacaaaaccgatggaatggtcgtcgagacagattgaacgacgccaagggtgaggtatgcagacatctttgatg |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47234781 |
atcatcacctgaccaaggatacactgaaacaaaaccgatggaatggtcgtcgagacagattgaacgacgccaagggtgaggtatgcagacatctttgatg |
47234682 |
T |
|
| Q |
118 |
aaagtttgagcttcttcccttgaattgcaagttttccatcggatgttttttgttacttcatcgtcccctgcccataacatgaaattgtcaacgtctgttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47234681 |
aaagtttgagcttcttcccttgaattgcaagttttccatcggatgttttttgttacttcatcgtcccctgcccataacatgaaatcgtcaacgtctgtta |
47234582 |
T |
|
| Q |
218 |
gcttgaatggcctcagagatatcctagatagatccacctttgccatgttggtcaaatgatcattgttattctt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47234581 |
gcttgaatggcctcagagatatcctagatagatccacctttgccatgttggtcaaatgatcattgttattctt |
47234509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University