View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12893_low_6 (Length: 244)
Name: NF12893_low_6
Description: NF12893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12893_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 11 - 146
Target Start/End: Original strand, 41499620 - 41499758
Alignment:
| Q |
11 |
cacagatacgtcgatctatggataaacaatttactttggataaacaatctaatattatgagacataagtgtttatttataaggaggttcgacttcacttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41499620 |
cacagatacgtcgatctatggataaacaatttactttggataaacaatttaatattatgaaatataagtgtttatttataaggaggttcgacttcacttg |
41499719 |
T |
|
| Q |
111 |
gtttactttactttat---ttattattcatttacgaaag |
146 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41499720 |
gtttactttactttatttattattattcatttacgaaag |
41499758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University