View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12893_low_7 (Length: 229)
Name: NF12893_low_7
Description: NF12893
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12893_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 44 - 209
Target Start/End: Original strand, 36956849 - 36957013
Alignment:
| Q |
44 |
aaatactaaaccagtcaaaaaatatatttttagtagaatattggaattagagggtaatggagaggaggtggcggtatgtattatatattttagcgcctaa |
143 |
Q |
| |
|
||||||||||||||| |||||| | | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36956849 |
aaatactaaaccagtaaaaaaaaaaaattt-agtagaatattggaattagagggtaatggagaggaggtggcggtatgtattatatattttagcgcctaa |
36956947 |
T |
|
| Q |
144 |
ataaaataattagttaagttgattgtgtcggttgcattggggaagtgaactaatacaaaccaacgt |
209 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36956948 |
ataaaaaaattagttaagttgattgtgtcggttgcattggggaagtgaactaatacaaaccaacgt |
36957013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University