View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12894_high_3 (Length: 367)
Name: NF12894_high_3
Description: NF12894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12894_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 29 - 262
Target Start/End: Complemental strand, 6089460 - 6089230
Alignment:
| Q |
29 |
actatgatgttgaataatcatgaacctttgtctttgtcactttcatcaaataaaagtgttagtagtaatttacctttggagttgaatctacaaagatatg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6089460 |
actatgatgttgaataatcatgaacctttgtctttgtcactttcatcaaataaaagtgttagtagtaatttacctttggagttgaatctacaaagatatg |
6089361 |
T |
|
| Q |
129 |
gatctatgatttatggtggtggaggtgtgattcaagggttggttgaaggaggaggaggaagtggtggttcagttccatttactggatatgcttctgtttt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6089360 |
gatctatgatttatggtggtggaggtgtgattcaaggtttggttgaaggagg---aggaagtggtggttcagttccatttactggatatgcttctgtttt |
6089264 |
T |
|
| Q |
229 |
gaaggattctaggtttttgaaaccagctcaagaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
6089263 |
gaaggattctaggtttttgaaaccagctcaagaa |
6089230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University