View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12894_high_9 (Length: 310)
Name: NF12894_high_9
Description: NF12894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12894_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 304
Target Start/End: Complemental strand, 43610586 - 43610285
Alignment:
| Q |
1 |
cagagttgatgcagtgcacggcgtaggacgatagttaagctgagctcatcggtgtgagtaggacaatgattggagagagtggaacgtgcaataacttaga |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||| |
|
|
| T |
43610586 |
cagagttgatgcggtgcacggcgtaggacgacagttaagctgagctcatcggtgtgagtaggacaacgattggagagagtggaatgtgcaatcacttaga |
43610487 |
T |
|
| Q |
101 |
cactcaaattagcttatgaatgagatgagtgagaggattttattatagagtgtgtacatgtttctcctgatgcatatgattacttgccgatgaggttaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43610486 |
cactcaaattagcttatgaatgagatgagagagaggattttatta--gagtgtgtacatgtttctcctgatgcatatgattacttgccgatgaggttaca |
43610389 |
T |
|
| Q |
201 |
tgcgtatttcggcatctaatttgtggtgaagcctaatgaggatttgggcttaggcgagaaatttaaagttgaagttgattcgaatatccaaccatattct |
300 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| | ||||||||||||||| | |
|
|
| T |
43610388 |
tgtgtatttcaacatctaatttgtggtgaagcctaatgaggatttgggcttaggcgagaaatttgaagttaaagttgatttggatatccaaccatattgt |
43610289 |
T |
|
| Q |
301 |
tcga |
304 |
Q |
| |
|
|||| |
|
|
| T |
43610288 |
tcga |
43610285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University