View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12895_low_10 (Length: 267)
Name: NF12895_low_10
Description: NF12895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12895_low_10 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 252
Target Start/End: Original strand, 5543 - 5775
Alignment:
| Q |
20 |
ccttccatatcaattctctcctcatttggccaattcgacattctacttggaaaattagaccctccaacttgaaacttcggttcgtgttgttcccttctta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
5543 |
ccttccatatcaattctctcctcatttggccaattcgacattctccttggaaaattagaccctccaacttgaaacttcgattcatgttgttcccttctta |
5642 |
T |
 |
| Q |
120 |
ttgctttacccccttcatctctacttttattgacatcataaccgttccccgaaactcctttctccctaccatcctcgtaacgattcagaatcctctcacg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5643 |
ttgctttacccccttcatctctacttttattgacatcataaccgttccccggaactcctttctccctaccatcctcgtaacgattcagaatcctctcacg |
5742 |
T |
 |
| Q |
220 |
tcgttccttattcaaccttcctgaatccctttg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5743 |
tcgttccttattcaaccttcctgaatccctttg |
5775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University