View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12895_low_15 (Length: 226)
Name: NF12895_low_15
Description: NF12895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12895_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 10383196 - 10383004
Alignment:
| Q |
19 |
tttggtggggtggtgtagtgaagttcgccggtcggcattgatcggcggattgtggtggtttgttgagggggtgagaaattggaatggtggggtgagaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10383196 |
tttggtggggtggtgtagtgaagttcgccggtcggcattgatcggcggattgtggtggtttgttgagggggtgagaaattggaatggtggggtgagaaag |
10383097 |
T |
|
| Q |
119 |
tgagcgtgatagtgatgaggttattatatggtttgaattttgcatgtaaataattgcatgaaatttgcaacatttgtgggtatattattatgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10383096 |
tgagcgtgatagtgatgaggttattatatggtttgaattttgcatgtaaataattgcatgaaatttgcaacatttgtgggtatattattatgt |
10383004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University