View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12896_low_10 (Length: 238)
Name: NF12896_low_10
Description: NF12896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12896_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 221
Target Start/End: Complemental strand, 12533577 - 12533371
Alignment:
| Q |
15 |
cacagaaagaagaaggctcatgtagatcataccttttctagcaactctcgaagaggaccagaaattgaagatcaaagtcaatgtgtcattgtggcttgat |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12533577 |
cacagaaagaagaaggctcgtgtagatcataccttttctagcaactctcaaagaggaccagaaattgaagatcaaagtcaatgtgtcattgtggcttgat |
12533478 |
T |
 |
| Q |
115 |
ttaataaagagtaaaaaacaaaagcaattgattaacaagaaaacctgcaaataatatatgatgcgaaattattcaatttcagcctcaaatgcaaaattga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12533477 |
ttaataaagagtaaaaaacaaaagcaattgattaacaagaaaacatgcaaataatatattatgcaaaattattcaatttcagcctcaaatgcaaaattga |
12533378 |
T |
 |
| Q |
215 |
ggaacca |
221 |
Q |
| |
|
||||||| |
|
|
| T |
12533377 |
ggaacca |
12533371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University