View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12896_low_7 (Length: 271)
Name: NF12896_low_7
Description: NF12896
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12896_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 7 - 207
Target Start/End: Complemental strand, 335298 - 335098
Alignment:
| Q |
7 |
aaatctgcactaacaaggagctaataggctgccnnnnnnncaagcaaccatgataaatttcttatcacctaaaaagaacctaaaagtaacaaagtactca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
335298 |
aaatctgcactaacaaggagctaataggctgccaaaaaaacaagcaaccatgataaatttcttatcacctaaaaagaacctaaaagtaacaaagtactca |
335199 |
T |
 |
| Q |
107 |
atttctagtaaatggttgttctactggtcacaattctgctttctcctaacacctcaaacttattaagtgcccacgaagaacttagatttaaggaaaatcc |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
335198 |
atttctagtaaatggttgttctaccggtcacaattctgctttctcctaacacctcaaacttattaagtgcccacgaagaacttagatttaaggaaaatcc |
335099 |
T |
 |
| Q |
207 |
a |
207 |
Q |
| |
|
| |
|
|
| T |
335098 |
a |
335098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University