View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12897_high_5 (Length: 249)
Name: NF12897_high_5
Description: NF12897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12897_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 39529178 - 39529423
Alignment:
| Q |
1 |
agaaaatgcaaaagttgaaaccgaaacaacatgacaaagaagatatatttctattttaagtaaccttgcatgataagttggtaacagacataaacaagga |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39529178 |
agaaaatgcaaaagttgaaacctaaacaacatggcaaagaagatatgtttctattttaagtaaccttgcatgataagttggtaacagacataaacaagga |
39529277 |
T |
|
| Q |
101 |
gcattacaaactaagcatccttaacgtatcgcatccgatactcatatcttgtttgtgcttcatcgacaaaaatggcaaaaatgtcataaatatgatccct |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39529278 |
gcattacaaactaagtatccttaacgtatcgcatccgatactcatatcttgtttgtgcttcgtcgacaaaaatggcaaaaatgtcataaatatgatccct |
39529377 |
T |
|
| Q |
201 |
tgaaaataattcctacaattgctaataaaagctcttcttctcactc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39529378 |
tgaaaataattcctacaattgctaataaaagctcttcttctcactc |
39529423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University