View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12897_high_7 (Length: 215)
Name: NF12897_high_7
Description: NF12897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12897_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 24 - 199
Target Start/End: Original strand, 1753117 - 1753292
Alignment:
| Q |
24 |
aatgggaggaaccagagtgcaaaggctttctggaatgcaaaagcaagtgcttagcttatacagaggatttcttcgtgcagcacgttccaaaccagacgaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| || |
|
|
| T |
1753117 |
aatgggaggaaccagagtgcaaaggctatctggaatgcaaaagcaagtgcttagcttatacagaggatttcttcgtgctgcacgttccaaaccggaccaa |
1753216 |
T |
 |
| Q |
124 |
gaacgccgcaacatagaatccatagtatctcaagaatttcgtcacaattcaaaacaagttgataggaagaattttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1753217 |
gaacgccgcaacatagaatccatagtatctcaagaatttcgtcacaattcaaaagaagttgataggaagaattttc |
1753292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University