View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12897_low_2 (Length: 338)
Name: NF12897_low_2
Description: NF12897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12897_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 264
Target Start/End: Original strand, 30393302 - 30393548
Alignment:
| Q |
19 |
taacatgcagctgaatgctatgtcaattttgcctttccattttgtgtttaaaaattttcctactccaaatttctttaactttccatttgtgtgatg-gaa |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
30393302 |
taacatgcagctcaatgctatgtcaattttgcctttccattttgtgtttaacaattttcctactccaaatttctttaactttccctttgtgtgatgagaa |
30393401 |
T |
|
| Q |
118 |
ttgaattcacgggctagagtattgaaaagttgtcctttggatctataggctctattattgttgtcatggatgagttttatgattccatgcatcaaaagga |
217 |
Q |
| |
|
||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30393402 |
ttgaattcatggggtagagtcttgaaaagttgtcctttggatctataggctctattattgttgtcatggatgagttttatgattccatgcatcaaaagga |
30393501 |
T |
|
| Q |
218 |
ttcatggagggttgtggggtgttagttctcatcaccattctatcaaa |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30393502 |
ttcatggagggttgtggggtgttagttctcatcaccattctatcaaa |
30393548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 269 - 332
Target Start/End: Original strand, 30393589 - 30393655
Alignment:
| Q |
269 |
tattttttatcaaacattttgaactta---tatcataatgtttatgtttatccatgcttcatctcac |
332 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
30393589 |
tattttttatcaaacattttgaacttatattatcataatgtttatgtttatctatgcttcatttcac |
30393655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University