View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12897_low_4 (Length: 291)
Name: NF12897_low_4
Description: NF12897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12897_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 281
Target Start/End: Original strand, 37111668 - 37111930
Alignment:
| Q |
19 |
tggctttgattagaccggcgataactatgaagataatgacagccatgtgtaagagtgtggctatgtagttgaagatggaagagcctttggtgctgtaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111668 |
tggctttgattagaccggcgataactatgaagataatgacagccatgtgtaagagtgtggctatgtagttgaagatggaagagcctttggtgctgtaaac |
37111767 |
T |
|
| Q |
119 |
tgcaagggctgttatggctactagagctgcaatagcaatagggtcaagatggccatagtcagggttcatattgtgaactattatacgaaaatcatcaggg |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111768 |
tgcaagggctgtgatggctactagagctgcaatagcaatagggtcaagatggccatagtcagggttcatattgtgaactattatacgaaaatcatcaggg |
37111867 |
T |
|
| Q |
219 |
tttttgttgcagagggtggcaaaataggaggtccatgatcgagctactgcggcgttgcctatg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37111868 |
tttttgttgcagagggtggcaaaataggaggtccatgatcgagctaccgcggcgttgcctatg |
37111930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 277
Target Start/End: Original strand, 37119923 - 37120181
Alignment:
| Q |
19 |
tggctttgattagaccggcgataactatgaagataatgacagccatgtgtaagagtgtggctatgtagttgaagatggaagagcctttggtgctgtaaac |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| || | ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37119923 |
tggctttgattagaccggcgattactatgaagataatgacagccatgtggaacattgtggctatgtagttgaagatggaagaacctttggtgctgtaaac |
37120022 |
T |
|
| Q |
119 |
tgcaagggctgttatggctactagagctgcaatagcaatagggtcaagatggccatagtcagggttcatattgtgaactattatacgaaaatcatcaggg |
218 |
Q |
| |
|
|||||| ||||| ||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37120023 |
tgcaagagctgtgatggctactagggctccaatagcaatagggtcaagatggccataatcaggattcatattgtgaactattatacgaaaatcatcaggg |
37120122 |
T |
|
| Q |
219 |
tttttgttgcagagggtggcaaaataggaggtccatgatcgagctactgcggcgttgcc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
37120123 |
tttttgttgcagagggtggcaaaataggaggtccatgatcgagctaccgccgcgttgcc |
37120181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 152 - 265
Target Start/End: Complemental strand, 37136197 - 37136084
Alignment:
| Q |
152 |
agcaatagggtcaagatggccatagtcagggttcatattgtgaactattatacgaaaatcatcagggtttttgttgcagagggtggcaaaataggaggtc |
251 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| | ||||||||||||||| | ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37136197 |
agcaatagggtcaagatgaccataatcagggttcatattgtggaatattatacgaaaatcgttaggatttttgttgcagagggtggcaaaataggaggtc |
37136098 |
T |
|
| Q |
252 |
catgatcgagctac |
265 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37136097 |
catgatcgagctac |
37136084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University