View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12898_high_19 (Length: 312)
Name: NF12898_high_19
Description: NF12898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12898_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 306
Target Start/End: Complemental strand, 52251654 - 52251366
Alignment:
| Q |
18 |
gaaagaacgtccaaaagactggtggcagaaatgcagcagtccagactttccggaagaagagttcaggagatgtttccggatgagcaaagcaacgttcgag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52251654 |
gaaagaacgtccaaaagactggtggcagaaatgcagcagtccagactttcccgaagaagagttcaggagatgtttccggatgagcaaagcaacgttcgag |
52251555 |
T |
|
| Q |
118 |
tttatatgccaagaacttgaatcagctgtttcaaagaaaaacactttgctaagggatgcaattccggggcggcagcgcgtggcggtttgtatctggagac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52251554 |
tttatatgccaagaacttgaatcagctgtttcaaagaaaaacactttgctaagggatgcaattccggggcggcagcgcgtggcggtttgtatctggagac |
52251455 |
T |
|
| Q |
218 |
tcgccaccggtgatcctctaaggctggtttcaaagaggttcggtttgggtatatccacctgtcataagctggttcttgaggtctgtgct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52251454 |
tcgccaccggtgatcctctaaggctggtttcaaagaggttcggtttgggtatatccacctgtcataagctggttcttgaggtttgtgct |
52251366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University