View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12898_high_30 (Length: 234)

Name: NF12898_high_30
Description: NF12898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12898_high_30
NF12898_high_30
[»] chr6 (1 HSPs)
chr6 (1-215)||(33636733-33636944)
[»] chr2 (1 HSPs)
chr2 (1-30)||(4691112-4691141)


Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 33636733 - 33636944
Alignment:
1 gtttttatggggaaactcaagtgttaatacatgtagataaaaatacaaatcatatgcagataataagattttaaatgactctactttgataaagaatgta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33636733 gtttttatggggaaactcaagtgttaatacatgtagataaaaatacaaatcatatgcagataataagattttaaatgactctactttgataaagaatgta 33636832  T
101 tgagtatcaatcaagaaaatcacagtagcagttgagctgacggcaaaaatgaataaacacggcgaaaggacatggcagatctccttcgacgaagatggtg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||    
33636833 tgagtatcaatcaagaaaatcacagtagcagttgagctgacggcaaaaatgaataaacacggcgaaaggacatggcagatctccttcgacgaaga---tg 33636929  T
201 gtagctggagcttcg 215  Q
    |||||||||||||||    
33636930 gtagctggagcttcg 33636944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 4691112 - 4691141
Alignment:
1 gtttttatggggaaactcaagtgttaatac 30  Q
    ||||||||||||||||||||||||||||||    
4691112 gtttttatggggaaactcaagtgttaatac 4691141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University