View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12898_low_11 (Length: 413)
Name: NF12898_low_11
Description: NF12898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12898_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 2e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 17 - 126
Target Start/End: Complemental strand, 3209261 - 3209152
Alignment:
| Q |
17 |
aaagagtggtggggttggtttggttatgggatattactttgggtttgttttgcttttcttgagtttaattactaccatgtgagaagagaatgattctgat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3209261 |
aaagagtggtggggttggtttggttatgggatattactttgggtttgttttgcttttcttgagtttaattactaccatgtgagaagagaatgattctgaa |
3209162 |
T |
|
| Q |
117 |
gtggttcttt |
126 |
Q |
| |
|
||| |||||| |
|
|
| T |
3209161 |
gtgattcttt |
3209152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 243 - 321
Target Start/End: Complemental strand, 3209025 - 3208947
Alignment:
| Q |
243 |
ctgattgagatctgattcgttagatgatgatttgtaattttgtatccaatttagcaattcagcttttattacagatccc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3209025 |
ctgattgagatctgattcgttagatgatgatttgtaattttgtatccaatttagcaattcagcttttattacagatccc |
3208947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University