View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12898_low_15 (Length: 337)
Name: NF12898_low_15
Description: NF12898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12898_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 207 - 322
Target Start/End: Original strand, 12601581 - 12601696
Alignment:
| Q |
207 |
taccatgattgcatcagcagataaggttatatcattagcaaagtacaaatgatataaataaggatcatttgaggatagattaatgggtttccacaagtga |
306 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12601581 |
taccatgattgcatcagcagataaggttacatcattcgcaaagtacaaatgatataaataaggatcatttgaggatagattaatgggtttccacaagtga |
12601680 |
T |
 |
| Q |
307 |
tcttccactaatttat |
322 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12601681 |
tcttccactaatttat |
12601696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University