View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12898_low_19 (Length: 314)
Name: NF12898_low_19
Description: NF12898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12898_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 8e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 17 - 125
Target Start/End: Original strand, 6753021 - 6753129
Alignment:
| Q |
17 |
taggctatgaggattgtgcaatttctgaagctcgtggacactctggagggatatggatattaaaatctcaaaattgcacatatgatattgagattataga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6753021 |
taggctatgaggattgtgcaatttctgaagctcgtggacactctggagggatatggatattaaaatctcaaaattgcacatatgatattgagattataga |
6753120 |
T |
|
| Q |
117 |
taactattt |
125 |
Q |
| |
|
||||||||| |
|
|
| T |
6753121 |
taactattt |
6753129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 17 - 125
Target Start/End: Complemental strand, 1811513 - 1811405
Alignment:
| Q |
17 |
taggctatgaggattgtgcaatttctgaagctcgtggacactctggagggatatggatattaaaatctcaaaattgcacatatgatattgagattataga |
116 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1811513 |
taggctatgagaattgtgcaatttctgaagctcgtggacactctggaggtatatggatattaaaatctcaaaattgcacatatgatattgagattataga |
1811414 |
T |
|
| Q |
117 |
taactattt |
125 |
Q |
| |
|
||||||||| |
|
|
| T |
1811413 |
taactattt |
1811405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 175 - 264
Target Start/End: Complemental strand, 1028341 - 1028252
Alignment:
| Q |
175 |
tctgttctgtcctatctattatgcaagtcgtaccggattcaatggtggtgatggtgatgataacaccgttgatatcccacctaactccgc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
1028341 |
tctgttctgtcctatctattatgcaagttgtaccggattcaatggtggtgatggtgatgataccaccgttcatatcccacctaactccgc |
1028252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University