View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12898_low_21 (Length: 296)
Name: NF12898_low_21
Description: NF12898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12898_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 32822184 - 32821915
Alignment:
| Q |
1 |
ggtggtagtaatgttatggaagagtatgattctgttagtgctggtgatgctggtgcttattctaatttggatgagttgtatgtgaataatcctcgagcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822184 |
ggtggtagtaatgttatggaagagtatgattctgttagtgctggtgatgctggggcttattctaatttggatgagttgtatgtgaataatcctcgagcta |
32822085 |
T |
 |
| Q |
101 |
ttttaccttgctttgttgtaatctacagaggcttttgataatgtgtattgtttggttttttgttggattaggggacgaaatttctttgcaatgtcacttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32822084 |
ttttaccttgctttgttgtaatctacagaggcttttgataatgtgtat------------tgttggattaggggacgaaatttctttgcaatgtcacttg |
32821997 |
T |
 |
| Q |
201 |
atggtgtttttagttcttttcttaattaatagtgtcctctagctaaatttagtttagttcagtggtgttttttaggggaagt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32821996 |
atggtgtttttagttcttttcttaattaatagtgtcctctagctaaatttagtttagttcagtggtgttttttaggggaagt |
32821915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University