View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12898_low_23 (Length: 261)
Name: NF12898_low_23
Description: NF12898
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12898_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 30274766 - 30274532
Alignment:
| Q |
17 |
aaatgcaacaacagaagagcatgttagcttacaaactgatgaagccaaacaggttttccacttccctcccttctgtttattattgagtttcactatgaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30274766 |
aaatgcaacaacagaagagcatgttagcttacaaactgatgaagccaaacaggttttccacttccctcccttctgtttattattgagtttcactatgaga |
30274667 |
T |
 |
| Q |
117 |
gagttttgaaaacaacatgcttctcaatttctcatccattatctttattccttgaacagtttattatggatgtgcaattcctagtggaaattggaatgta |
216 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30274666 |
g--ttttgaaaacaacatgcttctcaatttctcatccattatctttattccttgaacagtttattatggatgtgcaattcctagtggaaattggaatgta |
30274569 |
T |
 |
| Q |
217 |
tggaggatatttctccactgatcctttacttcttctc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30274568 |
tggaggatatttctccactgatcctttacttcttctc |
30274532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 46270512 - 46270591
Alignment:
| Q |
18 |
aatgcaacaacagaagagcatgttagcttacaaactgatgaagccaaacaggttttccacttccctcccttctgtttatt |
97 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||| | |||||| |||| |||||||| |
|
|
| T |
46270512 |
aatgcaataacagaagagcatgtgagcttacaaactgatgaggccaaacaggtttttgatttccctaccttgtgtttatt |
46270591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University