View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12899_high_20 (Length: 327)
Name: NF12899_high_20
Description: NF12899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12899_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 14 - 307
Target Start/End: Original strand, 4286188 - 4286482
Alignment:
| Q |
14 |
atatacacctccatagagcattcaagttttttgataaaaatcaatctgggtatattgaacttgaggataattaagtaagctaactcttcatttaagacaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4286188 |
atatacacctccatagagcattcaagttttttgataaaaatcaatctcggtatattgaacttgaggataattaagtaagctaactcttcatttaagacaa |
4286287 |
T |
 |
| Q |
114 |
gactctgttatcattcccttggcccatcatggcataaccttagc-nnnnnnnntcacataaaagtagaggtctgttcaattttcactgggcataacagta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4286288 |
gactctgttatcattcccttggcccatcatggcataaccttagcaaaaaagaatcacataaacgtagaggtctgttcaattttcaccgggcataacagta |
4286387 |
T |
 |
| Q |
213 |
ccatgttctacaagttcgatagaggtctcatctgcaagcaaatacataagttacaatcactcaccaccaagttattatattgaagattgaaccaa |
307 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4286388 |
ccatgttctactagttcgatagaggtctcatctgcaagcaaatacataagttacaatcactcaccaccaagttattatattgaagattgaaccaa |
4286482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 18 - 80
Target Start/End: Complemental strand, 21387211 - 21387149
Alignment:
| Q |
18 |
acacctccatagagcattcaagttttttgataaaaatcaatctgggtatattgaacttgagga |
80 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
21387211 |
acacctccaaagagcattccaattttttgataaaaacgaatctgggtttattgaacttgagga |
21387149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University