View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12899_high_26 (Length: 262)
Name: NF12899_high_26
Description: NF12899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12899_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 5053603 - 5053839
Alignment:
| Q |
1 |
ctcatttcacttgtttgcatcacagaatttgaatcaatttctgaaaactatacaactactattgtcccttgacggtgacaaaactaatactaccaactat |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
5053603 |
ctcatttcacttgttagcatcacagaatttgaatcaatttctgaaaactatacaactactattgtccctcgacggtggcaaaactaatactaccaactat |
5053702 |
T |
|
| Q |
101 |
agattatatatagtggttctagttatgttgcaaacctttatattgcagaaaaatgcaggaataagatgtcaaaattgcggttgcaatactgttgtggaga |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053703 |
agattatatatagtggttctagttacgttgcaaacctttatattgcagaaaaatgcgggaataagatgtcaaaattgcggttgcaatactgttgtggaga |
5053802 |
T |
|
| Q |
201 |
ctttaaaatcccttgtattacagtggcaatactgttg |
237 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5053803 |
ctttaaaatcccttatattacagtggcaatactgttg |
5053839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 241
Target Start/End: Original strand, 5053828 - 5053886
Alignment:
| Q |
183 |
gcaatactgttgtggagactttaaaatcccttgtattacagtggcaatactgttgcgga |
241 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
5053828 |
gcaatactgttgtggaggcttcaaaatcccttatattaccgtggcaatactgttgcgga |
5053886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University