View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12899_low_32 (Length: 258)
Name: NF12899_low_32
Description: NF12899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12899_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 38251917 - 38252154
Alignment:
| Q |
1 |
agatatccatggcagtgagctaaacaaattaagcatagaccccaataaaggtaatcatggtaagtggctagaggaaggctgctgaacttaagtcacaaaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38251917 |
agatgtccatggcagtgagctaaacaaattaagcatagaccccaataaaggtaatcatggtaagtggctagaggaaggctgctgaacttaagtcacaaaa |
38252016 |
T |
 |
| Q |
101 |
gttcctcttttaggccacatgttctttaaaacaatatttgtttgatcatacgatagttttcatatatagtttcttttgtttcccggagtatcctccgtgg |
200 |
Q |
| |
|
||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38252017 |
gttcctcttttaggcaatat--tctttaaaacaatatttgtttgatcatacgatagttttcatatatagtttcttttgtttcccggagtatcctccgtgg |
38252114 |
T |
 |
| Q |
201 |
ttgcatagacatcattcatatcatagtttacgaaacatat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38252115 |
ttgcatagacatcattcatatcatagtttacgaaacatat |
38252154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 31473262 - 31473315
Alignment:
| Q |
159 |
ttcatatatagtttcttttgtttcccggagtatcctccgtggttgcatagacat |
212 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
31473262 |
ttcatttatagtttcttttgtttccgagagtatcctccacggttgcagagacat |
31473315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University