View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12899_low_40 (Length: 214)
Name: NF12899_low_40
Description: NF12899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12899_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 54786623 - 54786804
Alignment:
| Q |
16 |
tatacttgggatccaaaaattaacttcacaaattgggcaagtaatgagcacttttatcagggtgattggctatgtaagttcgttccttcctgacacatgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54786623 |
tatacttgggatccaaaaattaacttcacaaattgggcaagtaatgagcacttttaccagggtgattggctatgtaagttcgttccttcctgacacatgt |
54786722 |
T |
|
| Q |
116 |
tgattaatatcattgcaaataattcatttattattaactgaagtgaattctcttttttgtaaatagattttggttttgataag |
198 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54786723 |
tgattaatatcattgcaaat-atttatttattattaactgaagtgaattctcttttttgtaaatagattttggttttgataag |
54786804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University