View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12899_low_9 (Length: 410)
Name: NF12899_low_9
Description: NF12899
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12899_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 20 - 403
Target Start/End: Complemental strand, 54719000 - 54718617
Alignment:
| Q |
20 |
cccaattccgacgaaaatgttactttccctaattacgatgaacaacacaacaaccttgcctctaagtttcgtaaccaccagatcactgacaaaaccgccg |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54719000 |
cccaattccgacgaaaatgtcactttccctaattacgatgaacaacacaacaaccttgcctctaagtttcgtaaccaccagatcactgacaaaaccgccg |
54718901 |
T |
 |
| Q |
120 |
ccgctctcatgcttctcaccgccgattccggaggtctcctccacatgcctgctgactttgactcctcccaaaacgacgtcgttaacacctcctccgtgag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54718900 |
ccgctctcatgcttctcaccgccgattccggaggtctcctccacatgcctgctgactttgactcctcccaaaacgacgtcgttaacacctcctccgtgag |
54718801 |
T |
 |
| Q |
220 |
tatattcatattttctcactccgtttattaattaacaactttatcgtttttattaccgaatattttaatattgttagcttttacaggctgctggtgacgc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54718800 |
tatattcatattttctcactccgtttattaattaacaactttatcgtttttattactgaatattttaatattgttagcttttacaggctgctggtgatgc |
54718701 |
T |
 |
| Q |
320 |
ttccgttcaagctctcttcaacggtttctccggatctctccacggtgtcgctcaacctcaccattttcaacctccacaggttct |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54718700 |
ttccgttcaagctctcttcaacggtttctccggatctctccacggtgtcgctcaacctcaccattttcaacctccacaggttct |
54718617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University