View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1289_high_13 (Length: 279)
Name: NF1289_high_13
Description: NF1289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1289_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 22 - 267
Target Start/End: Complemental strand, 49932381 - 49932134
Alignment:
| Q |
22 |
ctctctatccgttgtgggagtgagtgtttaggcggggcctaagaatgaatgatttatgcgctcctgcgtacgtgtcaatcaaggccnnnnnnnnnnnngc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49932381 |
ctctctatccgttgtgggagtgagtgtttaggcggggcctaagaatgaatgatttatgcgctcctgcgtacgtgtcaatcaaggccttttttctttttgc |
49932282 |
T |
|
| Q |
122 |
atatgatgccatgcctgctgttacttcactcggtcgatggggataaaccactgtatcttgc--nnnnnnnnnatgctacttagacttgaatcaaccaacc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49932281 |
ctatgatgccatgcctgctgttacttcactcggtcaatggggataaaccactgtatcttgctttttttttttatgctacttagacttgaatcaaccaacc |
49932182 |
T |
|
| Q |
220 |
ggatctgtttgatctcttgcggcgagtgctgcttctttgacctatgct |
267 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
49932181 |
ggatctgtttgatctcttgcgacgagtgctgcttctttgacctgtgct |
49932134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 192 - 252
Target Start/End: Complemental strand, 48782085 - 48782026
Alignment:
| Q |
192 |
atgctacttagacttgaatcaaccaaccggatctgtttgatctcttgcggcgagtgctgct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||| ||||| ||||||||||||||||| |
|
|
| T |
48782085 |
atgctacttagacttgaatcaaccaaccgcattagttcgatct-ttgcggcgagtgctgct |
48782026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University