View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1289_low_12 (Length: 390)
Name: NF1289_low_12
Description: NF1289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1289_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 9 - 360
Target Start/End: Complemental strand, 32617088 - 32616737
Alignment:
| Q |
9 |
atcatagggacatgtttcctcctcattgggtgtgctggcttttccgcgttttacatattgcaggtaatttttattttattttgaaatcgacaatgttagt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32617088 |
atcatagggacatgtttcctcctcattgggtgtgctggcttttccgcgttttacatattgcaggtaattttaattttattttgaaatcgacaatgttagt |
32616989 |
T |
 |
| Q |
109 |
attgttatcgataaaaaattaatgtatgatatgagaaacatgtatgtatatgtttggtttaatgtgatgattttgtaggccataacgttgagaaagtacc |
208 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616988 |
gttgttatcgataaaaaattaacgtatgatatgagaaacatgtatgtatatgtttggtttaatgtgatgattttgtaggccataacgttgagaaagtacc |
32616889 |
T |
 |
| Q |
209 |
cagcaccaatgtctctggcaacttgggtttgtttcattggcgcacttcaaagcttcgtggtagcattcttcgcagagcgccacaactctcatgcttgggc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616888 |
cagcaccaatgtctctggcaacttgggtttgtttcattggcgcacttcaaagcttcgtggtagcattcttcgcagagcgccacaactctcatgcttgggc |
32616789 |
T |
 |
| Q |
309 |
tcttggttgggatacaagactctttgccccagcttacgcggttagtgttttg |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616788 |
tcttggttgggatacaagactctttgccccagcttacgcggttagtgttttg |
32616737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 185 - 261
Target Start/End: Complemental strand, 10624650 - 10624574
Alignment:
| Q |
185 |
aggccataacgttgagaaagtacccagcaccaatgtctctggcaacttgggtttgtttcattggcgcacttcaaagc |
261 |
Q |
| |
|
|||| ||||| ||||||||||| |||||| ||||| ||||| || |||||||| || ||||| |||||||||||| |
|
|
| T |
10624650 |
aggctataacattgagaaagtatccagcagagatgtcactggccacgtgggtttgctttattggtgcacttcaaagc |
10624574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University