View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1289_low_14 (Length: 368)
Name: NF1289_low_14
Description: NF1289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1289_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 30 - 360
Target Start/End: Complemental strand, 49932465 - 49932134
Alignment:
| Q |
30 |
tcaccaatctatatagttctttctcaaccatcaatctttgtagattgattcctttcgtccgttcttttgatctagccatagtgactctctatccgttgtg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
49932465 |
tcaccaatctatatagttctttctcaaccatcagtctttgtagactgattcctttcgtgcgtttttttgatctagccatagtgactctctatccgttgtg |
49932366 |
T |
 |
| Q |
130 |
ggagtgagtgtttaggcggggcctaagaatgaatgatttatgcgctcctgcgtacgtgtcaatcaaggccnnnnnnnnnnnngcatatgatgccatgcct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
49932365 |
ggagtgagtgtttaggcggggcctaagaatgaatgatttatgcgctcctgcgtacgtgtcaatcaaggccttttttctttttgcctatgatgccatgcct |
49932266 |
T |
 |
| Q |
230 |
gctgttacttcactcggtcgatggggataaaccactgtatcttgc-nnnnnnnnnnatgctacttagacttgaatcaaccaaccggatctgtttgatctc |
328 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49932265 |
gctgttacttcactcggtcaatggggataaaccactgtatcttgctttttttttttatgctacttagacttgaatcaaccaaccggatctgtttgatctc |
49932166 |
T |
 |
| Q |
329 |
ttgcggcgagtgctgcttctttgacctatgct |
360 |
Q |
| |
|
||||| ||||||||||||||||||||| |||| |
|
|
| T |
49932165 |
ttgcgacgagtgctgcttctttgacctgtgct |
49932134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 285 - 345
Target Start/End: Complemental strand, 48782085 - 48782026
Alignment:
| Q |
285 |
atgctacttagacttgaatcaaccaaccggatctgtttgatctcttgcggcgagtgctgct |
345 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||| ||||| ||||||||||||||||| |
|
|
| T |
48782085 |
atgctacttagacttgaatcaaccaaccgcattagttcgatct-ttgcggcgagtgctgct |
48782026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University