View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1289_low_25 (Length: 275)
Name: NF1289_low_25
Description: NF1289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1289_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 37 - 230
Target Start/End: Complemental strand, 34975901 - 34975708
Alignment:
| Q |
37 |
taggcctattgacttcatgatggaaagtaagttagaaggcataattgggagtagttctaggaattttgataattattttggaaatagtgatcatatgaat |
136 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34975901 |
taggcctattgacttcatgatggaaaataagttagaaggcataattgggagtagttctaggaattttgataattattttggaaatagtgatcatatgaat |
34975802 |
T |
 |
| Q |
137 |
atgaatatgggtgttgggattggaggagatatgatgaatggacaaaatgggttgccacagaattttcatcatgcatttggtggaatgtcatttg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34975801 |
atgaatatgggtgttgggattggaggagatatgatgaatggacaaaatgggttgccacagaattttcatcatgcatttggtggaatgtcatttg |
34975708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University