View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1289_low_29 (Length: 251)
Name: NF1289_low_29
Description: NF1289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1289_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 27066018 - 27066239
Alignment:
| Q |
1 |
agttgaagcagtagttttattataactagcaaaagaaatacctttcttgtcataatccttaaatgtattattattcccattgtaaactttaaacgaaacc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27066018 |
agttgaagtagtagttttattataactagcaaaagaaatacctttcttgtcataatccttaaatgtattattattcccattgtaaactttaaacgaaacc |
27066117 |
T |
 |
| Q |
101 |
ttatgatctaaatcagcacctttagcatagcctttgaaagtttcacttcctggagattttggataacctggattaagaccgtagttattgaaatccacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
27066118 |
ttatgatctaaatcagcacctttagcatagcctttgaaagtttcacttcctggagattttggataatctggattttgaccgtagttattgaaatccacct |
27066217 |
T |
 |
| Q |
201 |
tgaccccgcgctgcgaattctc |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
27066218 |
tgaccccgcgctgcgaattctc |
27066239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 73
Target Start/End: Original strand, 27079758 - 27079810
Alignment:
| Q |
21 |
tataactagcaaaagaaatacctttcttgtcataatccttaaatgtattatta |
73 |
Q |
| |
|
|||||| |||||||||||||||||| || || ||||||||||| || |||||| |
|
|
| T |
27079758 |
tataaccagcaaaagaaataccttttttatcgtaatccttaaacgtgttatta |
27079810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University