View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1290-Insertion-10 (Length: 107)
Name: NF1290-Insertion-10
Description: NF1290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1290-Insertion-10 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 9e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 9e-49
Query Start/End: Original strand, 6 - 107
Target Start/End: Original strand, 31808959 - 31809060
Alignment:
| Q |
6 |
cacaatgaagtgaaaagtttcacatcaatatcagtcttatatgctttagttgtggcaccaataaataagaaagtatagtcaactgaattatactacattg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31808959 |
cacaatgaagtgaaaagtttcacatcaatatcagtcttatatgctttagttgtggcaccaataaataagagagtatagtcaactgaattatactacattg |
31809058 |
T |
|
| Q |
106 |
at |
107 |
Q |
| |
|
|| |
|
|
| T |
31809059 |
at |
31809060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University